Computing...

Input interpretation:

SCNN1A  (human gene)


Standard name:

sodium channel, non-voltage-gated 1 alpha subunit


Alternate names:

BESC2  |  ENaCa  |  SCNEA  |  SCNN1  |  ...


Reference sequence:

CCTCAGAAAACTGATTTATCCTTGGGAAGGGTCAGTTTCT\n...  TAGGCAGGAGCTCAATAAATGTTTGTTGCATGAAGGAA


Reference sequence length:

30515 bp  (base pairs)

Source information
Contact Pro Premium Expert Support