Computing...

Input interpretation:

Scnn1a  (mouse gene)


Standard name:

sodium channel, nonvoltage-gated 1 alpha


Alternate names:

ENaC  |  mENaC  |  SCNEA  |  Scnn1  |  ...


Location:

species | Mus musculus  (mouse)\nlocus | chromosome 6  |  qF3\nstrand | plus\ncoordinates | 125321340 to 125344943


Reference sequence:

AGTCACAGCCCAGCCACACCTGGAGCCGGGAGCAGGAGGC\n...  AGGTAGGCAGATACTCAATAAATGCTTGTTCCATCAAA


Reference sequence length:

23604 bp  (base pairs)

Source information
Contact Pro Premium Expert Support