Computing...

Input interpretation:

tin  (fruit fly gene)


Standard name:

tinman


Alternate names:

HOX  |  NK4  |  Tin  |  TIN  |  ...


Location:

species | Drosophila melanogaster  (fruit fly)\nlocus | chromosome 3R  |  93D9\nstrand | plus\ncoordinates | 17204701 to 17207692


Reference sequence:

AGTACCAAAATCGAGCTGACAAATTGCAGACACGGTCGAG\n...  TTTATGTATATATTGGACAATAAATAAAGCTTAAGACC


Reference sequence length:

2992 bp  (base pairs)

Source information
Contact Pro Premium Expert Support