Computing...

Input interpretation:

chromosome 5  (human) | position | 12650000 bp  (base pairs)


Reference sequence at location:

... TTGAAAAATATCTCATTTGCTAAAATAAGACAGTAAAACA\nGTACAGTTTAAATATTTATA A AAATAGGAAAGTTTGGCAA\nAAAGAGAGGAGTACACACCTGTGACTACTGAGTTGCTGTG ...


Context:



Nearby genes:


Source information
Contact Pro Premium Expert Support