Wolfram|Alpha Life Sciences

Genomics & Molecular Biology

Human Genome ››

translate a DNA base sequence and find occurrences in the human genome
AAGCTAGCTAGC
find the DNA sequence at a given position on a chromosome
chromosome 5, 12.65 million base pairs
analyze a human gene and locate it on a chromosome
scnn1a
get information about a SNP
rs1323042

Mouse Genome ››

analyze a mouse gene
mouse gene scnn1a
locate a DNA sequence relative to a gene
100kbp upstream from mouse gene nampt

Fruit Fly Genome ››

analyze a fruit fly gene
fruit fly gene HOX
get a reference sequence for a fruit fly gene
fruit fly gene CRMP sequence

Comparative Genomics

get genome information about an organism
genome of mouseear cress
compare genomic data across organisms
how many chromosomes orangutan vs human vs chimp
compare genes across organisms
homologs of CCR5 gene

Oligonucleotides

calculate the molecular weight of an oligonucleotide
ATTGGGCAAAAA molecular weight ATTTAGGAGGAGTGATGCAGCGATA molecular weight
compute an oligonucleotide melting temperature
melting point GCTCGTAGCTACGT

Biomolecules

get information about a biomolecule
serotonin ubiquinone